rs281440 chr19:10289628 G>A
- Sequence
gggaggagctaaatgtgggggcgg[G/A]gctcggagtccagcttattatcat
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | -3.62 | 1.23 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, college completion, infant head circumference, plasma soluble intercellular adhesion molecule 1 (icam-1) (females), rheumatoid arthritis, soluble intercellular adhesion molecule 1 (icam-1), tetrology of fallot, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood