rs2820226 chr6:35077504 G>A
- Sequence
ggcacaggcctgtctgtgcccagc[G/A]gggctctggggacgtccaggaagt
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | 1.41 | 0.07 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, cystatin c in serum, fasting insulin, hdl cholesterol, height, homa-b, homa-ir, ldl cholesterol, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Coronary, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood