rs283720 chr8:127297720 A>G
- Sequence
attgttctctatagttttgctcca[A/G]taggtcaaggatatactagtatat
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 0.67 | 2.92 | 3.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, college completion, comorbid depressive syndrome and alcohol dependence, cystatin c in serum, late onset alzheimers disease, obesity with early age of onset (age >2), years of education