rs2838073 chr21:41612564 A>G
- Sequence
tttagacatgtgctcagtatcctt[A/G]ggtattcctgagggtgacatgaac
- ASB in cell types
- foreskin keratinocyte Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.26 | 2.83 | |||
| Peyer's patch | 1.41 | -0.84 | 1.00 |
Items per page:
1 – 2 of 2