rs28382728 chrX:123888185 A>G
- Sequence
ccatctctaccaaagatataaaaa[A/G]ttagccgggtgtggtggcgcatgc
- ASB for transcription factors
- ZN555_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN555_HUMAN | 2.54 | -2.58 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellum, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Thyroid, Vagina