rs283843 chr2:79041087 C>A
- Sequence
gtcaaacttttgaatgccaataat[C/A]taaagcatacagttttaggtaact
- ASB in cell types
- THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.85 | 0.87 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism with high iq, birth weight, ldl cholesterol, refractive error, rheumatoid arthritis, schizophrenia, spine bone mineral density (bmd), systolic blood pressure (sbp), waist hip ratio