rs2838758 chr21:45039517 A>G
- Sequence
atagaggaactgaaaataagggct[A/G]acatttaaaaattcctgagactga
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.25 | 2.10 | 1.81 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, hip bone mineral density (bmd), hypertension (early onset hypertension), parkinsons disease, triglycerides
GTEx eQTL Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid