rs28411343 chr4:139651370 C>T
- Sequence
ggtgtgtgtgtgtgtgtgtgtgtg[C/T]gtgttgggtaagcaggcaggaagg
- ASB in cell types
- neural cell LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 1.43 | -0.91 | 1.00 | |||
| LNCaP C4-2B (prostate carcinoma) | 2.51 | -4.74 | 2.00 |
Items per page:
1 – 2 of 2