rs284489 chr8:104945792 A>G
- Sequence
taaaatgccaggagcagcttctaa[A/G]gcaacattttccccatagttaata
- ASB for transcription factors
- ATF7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF7_HUMAN | 2.30 | -1.98 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), glaucoma (normal pressure glaucoma), hdl cholesterol, obesity with early age of onset (age >2), optic nerve degeneration in exfoliation glaucoma, optic nerve degeneration in normal-pressure glaucoma, refractive error, schizophrenia, systolic blood pressure (sbp)