rs28483241 chr11:1203848 C>T
- Sequence
caccctaaccagcaccagtgtgcc[C/T]ggggtggatcaggtatcctagaaa
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- GLIS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GLIS1_HUMAN | -4.43 | 2.67 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1