rs28488258 chr4:47564353 C>A
- Sequence
aagttttttttttttatttgcttt[C/A]ccccctccacactggattaccagg
- ASB in cell types
- foreskin keratinocyte neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.85 | -4.16 | 2.17 | |||
| neural cell | 1.41 | -0.56 | 1.00 |
Items per page:
1 – 2 of 2