rs2849405 chr18:12047119 T>C
- Sequence
caccagcagggcagcccctgatag[T/C]gcctctaacctgctgcctgctgcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma) GM19238 (female B-cells lymphoblastoid cell lines) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.57 | 0.51 | 1.31 | n/a | No Hit | |||
| STAG1_HUMAN | 1.76 | -0.48 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Vagina, Whole_Blood