rs28495790 chr4:7845937 G>A
- Sequence
caaaatgcaagctgtcatggagcc[G/A]ggcacgagggggcagcatatgcag
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) GM19240 (B cells Lymphoblastoid Cell Lines) gastroesophageal sphincter
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.49 | 0.92 | 1.26 | -1.74 | Weak Concordant | |||
| STAG1_HUMAN | 2.42 | -2.38 | 1.17 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Minor_Salivary_Gland, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood