rs28520549 chr4:182809170 G>A
- Sequence
atgaagaggccccaggacgggaag[G/A]gggttgctctccctgcagccccca
- ASB in cell types
- hematopoietic stem cells and progenitors MDM(monocyte derived macrophages)
- ASB for transcription factors
- TF7L2_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF7L2_HUMAN | 2.96 | -2.95 | 1.00 | n/a | No Hit | |||
| TF65_HUMAN | 2.09 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2