rs2852306 chr18:45565696 G>A
- Sequence
caggatgttcccagcacacgcatc[G/A]gctcctacccacatacagccaggg
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | 0.38 | 1.24 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, coronary artery disease (cad), diastolic blood pressure (dbp), homa-ir, neuroblastoma (brain cancer), premature ovarian failure, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp)