rs28544970 chr17:65914955 A>G
- Sequence
tggctaaagacctcgccatgcagc[A/G]gtcagttctcagtccccatctaac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) ARP-1(Plasma cell myeloma) monocyte-derived dendritic cells
- ASB for transcription factors
- IKZF1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 0.10 | 2.02 | 1.50 | n/a | No Hit | |||
| SPI1_HUMAN | 0.91 | 2.11 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2