rs28553894 chr10:73730085 C>A
- Sequence
tgaaaccgaacagctgtgtgattt[C/A]cgaggttatgttgcttctctacta
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) MOLT-4 (Adult T acute lymphoblastic leukemia) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- STAG1_HUMAN SPT5H_HUMAN MNT_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.37 | -0.64 | 1.00 | n/a | n/a | |||
| SPT5H_HUMAN | 2.98 | -0.50 | 1.25 | n/a | n/a | |||
| MNT_HUMAN | 2.40 | -0.33 | 1.12 | n/a | n/a | |||
| NR2C1_HUMAN | 2.68 | -1.42 | 1.00 | n/a | No Hit | |||
| COT1_HUMAN | 1.89 | -1.58 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 24
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood