rs285731 chr15:92683493 T>G
- Sequence
ctccagacctgggtatccctccct[T/G]acccactcaagtcttcatggcctt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) IPSC-derived bipolar neuron pancreas 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.91 | 2.05 | 1.54 | n/a | No Hit | |||
| STAG1_HUMAN | 0.86 | 2.27 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, fasting blood glucose, fasting insulin, homa-ir, longstanding arthritis, spine bone mineral density (bmd)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Thyroid, Whole_Blood