rs285819 chr8:105092387 T>G
- Sequence
catgagactcctactggtgaaaaa[T/G]tcacaatcacaatcaagaataata
- ASB in cell types
- neural progenitors HUES64 (embryonic stem cells) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | 2.21 | -1.65 | 1.00 | |||
| HUES64 (embryonic stem cells) | 2.17 | 0.06 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.46 | 0.10 | 1.31 |
Items per page:
1 – 3 of 3