rs285998 chr5:56413227 G>T
- Sequence
tgagacagcagcaaactgtgagag[G/T]ggctgggctcagcttgctgtttag
- ASB in cell types
- RPMI8226 (Plasma cell myeloma) macrophages form periferal blood
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -0.44 | 1.93 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1