rs28688222 chr4:186137389 C>T
- Sequence
ggtcagagcgaaagcataccctgt[C/T]cctcatgcacattcatatcatgtg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma) GM18505 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.44 | 1.05 | 1.15 | n/a | No Hit | |||
| STAG1_HUMAN | 1.20 | 0.98 | 1.04 | n/a | n/a |
Items per page:
1 – 2 of 2