rs28693900 chr15:38564292 A>G
- Sequence
cgggcgtggagatgtgggggagga[A/G]gtcggcgggcgggcgccggctccg
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.23 | 0.09 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 0.47 | 0.81 | 1.98 |
Items per page:
1 – 2 of 2