rs286994 chr12:41626872 T>C
- Sequence
tgactccagatcctgtactcttaa[T/C]ctctaatcctttaaagtccttcaa
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 1.79 | -0.24 | 1.25 | -5.34 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, stabilized warfarin dose