rs28711909 chr4:184848746 G>A
- Sequence
gaaagctgtattgccacttatgac[G/A]tagctcttggagtcatagtatcac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) SU-DHL-1 (Anaplastic large cell lymphoma) MDM(monocyte derived macrophages) macrophages form periferal blood
- ASB for transcription factors
- CEBPB_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -0.41 | 2.45 | 2.00 | n/a | No Hit | |||
| SPI1_HUMAN | 1.89 | 0.31 | 1.67 | n/a | No Hit |
Items per page:
1 – 2 of 2