rs28713277 chr1:119611839 G>A
- Sequence
gggaagaacaaggaagcctgacct[G/A]gccgggatttttgggtcctttttc
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | n/a | 2.60 | 1.33 |
Items per page:
1 – 1 of 1