rs28862617 chr21:10687426 T>C
- Sequence
attcatgtccattccattccgttc[T/C]gctcaagtccattccattccattc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.58 | 1.69 | 3.58 | |||
| HepG2 (hepatoblastoma) | 0.41 | 1.47 | 3.98 |
Items per page:
1 – 2 of 2