rs288830 chr20:54938644 G>A
- Sequence
agttaaagaggaatgcctaaaggt[G/A]tgaaaatggaaattgagttccaaa
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.73 | 1.65 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, hdl cholesterol change with statins, hypertension (early onset hypertension), premature ovarian failure, rheumatoid arthritis, serum creatinine, tetrology of fallot