rs288837 chr5:74168162 G>T
- Sequence
acgtgtgtgattatcttctggaaa[G/T]cctgttggcagtggactgattctc
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 3.06 | -3.42 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, asthma, comorbid depressive syndrome and alcohol dependence, fasting insulin, homa-ir, longstanding arthritis, resistance to kuru in aged women despite likely exposure, waist hip ratio