rs28971423 chr21:10709805 A>C
- Sequence
attcaattcgagtccattccattc[A/C]agttgattcctttccagtccattc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.07 | 1.32 | 3.33 | |||
| HepG2 (hepatoblastoma) | 0.28 | 1.46 | 4.23 |
Items per page:
1 – 2 of 2