rs289741 chr16:56983562 G>A
- Sequence
gtggcctgggagtcagcccagctc[G/A]cccctctctcctactgcccctccc
- ASB in cell types
- Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | -0.93 | 1.29 | 1.11 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), metabolic syndrome domains (atherogenic dyslipidemia - pc1), metabolic syndrome domains (atherogenic dyslipidemia - pc2), metabolic syndrome domains (multivariate analysis), microalbuminuria, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio