rs290243 chr9:90809055 G>A
- Sequence
gtggaaggccaccacttccttttg[G/A]ttaacaacaccaatcagctgatgg
- ASB in cell types
- macrophages form periferal blood monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.25 | 0.49 | 1.81 | -0.27 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Esophagus_Mucosa, Nerve_Tibial, Stomach, Testis, Thyroid