rs2903307 chr16:13511033 T>C
- Sequence
agaaagcaaaatttagcacatggt[T/C]cagtttggacgttcatcactacat
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.26 | 0.87 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), dna repair capacity in cultured peripheral lymphocytes (bpde-damage host-cell reactivation testing) in lung cancer cases and controls, irritible bowel syndrome, mitral annular calcium, premature ovarian failure, refractive error