rs2904647 chr8:17118071 G>A
- Sequence
ggtggttagttgttaacattttag[G/A]tgatgccagaagtacttgaaacaa
- ASB in cell types
- uterus gastroesophageal sphincter testis hASC (preadipocytes)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| uterus | -2.08 | 2.47 | 1.00 | |||
| gastroesophageal sphincter | 1.17 | -0.74 | 1.00 | |||
| testis | 2.27 | -1.94 | 1.00 | |||
| hASC (preadipocytes) | 0.79 | 1.57 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, birth weight, body mass index (bmi), longstanding arthritis