rs290753 chr5:56357443 A>G
- Sequence
ggacatttcaatcttggaaagagt[A/G]tcagtttagaaacacaaattaaat
- ASB in cell types
- BEAS-2B (bronchial epithelium)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BEAS-2B (bronchial epithelium) | 0.15 | 1.16 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, diabetic retinopathy in type 2 diabetes mellitus, fasting blood glucose, waist hip ratio