rs291197 chr11:86314904 G>A
- Sequence
cagacctggtgactgagaaattgg[G/A]tgtggaatctagaagtctgtactg
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.72 | 0.12 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood