rs292508 chr7:135170881 G>C
- Sequence
cgcgggcgccccatgctggcagtg[G/C]taatgccgccggctggcatccggt
- ASB in cell types
- MM1.S (plasma cell myeloma) KMS-11 (Plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.47 | 1.18 | 1.37 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic