rs292565 chr7:135188728 A>G
- Sequence
tgcccaagaggtcaggctgcttct[A/G]agcctcagaggcagcttctttcac
- ASB in cell types
- primary human epidermal keratinocytes GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 2.48 | -0.59 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid