rs293735 chr20:33337256 T>A
- Sequence
gagctggccccattcattcgtgca[T/A]tccttcattcatgcatttactgca
- ASB in cell types
- GM02630 (Fanconi anemi) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | -2.61 | 2.85 | 1.00 | |||
| foreskin keratinocyte | 1.25 | n/a | 2.33 |
Items per page:
1 – 2 of 2