rs296368 chr19:47869041 C>T
- Sequence
gagagtcctcggcttccacatacc[C/T]gttatggtgctccgtggccaccag
- ASB in cell types
- MS-1 (Small cell lung carcinoma) A549 (lung carcinoma) GM17942 (lymphoblastoid cell) spleen
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.61 | 0.85 | 1.31 | n/a | No Hit | |||
| RAD21_HUMAN | 0.23 | 1.02 | 1.21 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, ldl cholesterol change with statins, serum dehydroepiandrosterone sulphate (dheas), serum dehydroepiandrosterone sulphate (dheas) (females), total cholesterol, total cholesterol change with statins, triglycerides