rs2966853 chr16:85156948 C>G
- Sequence
tccatccatccatccatcctttct[C/G]catccatccatccattcacccatt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.08 | 0.69 | 1.91 |
Items per page:
1 – 1 of 1