rs297186 chr5:17189610 A>C
- Sequence
tggatgagcgccacctagtggccg[A/C]agtttaacttgaggacaactgcaa
- ASB in cell types
- THP-1 (acute monocytic leukemia) GM19099 (female B-cells Lymphoblastoid Cell Lines) epidermal keratinocytes
- ASB for transcription factors
- RAD21_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.05 | 1.74 | 1.59 | n/a | n/a | |||
| STAG1_HUMAN | 1.62 | 0.37 | 1.14 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol