rs298305 chr2:156437479 A>G
- Sequence
atgacatctggatgccattgccca[A/G]tggagaccgtgtgcagtctgggga
- ASB in cell types
- Kasumi-1 (acute myeloblastic leukemia) macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kasumi-1 (acute myeloblastic leukemia) | 1.92 | -1.70 | 1.50 | |||
| macrophages | 1.59 | -3.92 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Thyroid, Whole_Blood