rs2986217 chr1:68116961 C>G
- Sequence
ataaaaggttgccatgaacctgta[C/G]gactggccccgacccctcccactc
- ASB in cell types
- GM02630 (Fanconi anemi)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.57 | 0.76 | 1.58 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, diastolic blood pressure (dbp), fasting blood glucose, hdl cholesterol, microalbuminuria, systolic blood pressure (sbp)