rs2994985 chr1:241485884 C>T
- Sequence
aacctgtcaaaggcaaataaagct[C/T]atctgtgctattgccaccttgtgg
- ASB in cell types
- LNCaP (prostate carcinoma) HS-SY-2(Monophasic synovial sarcoma) GM23338 Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.18 | -0.01 | 1.20 | |||
| HS-SY-2(Monophasic synovial sarcoma) | n/a | 2.68 | 3.00 | |||
| GM23338 | 1.15 | -0.89 | 1.00 | |||
| Kelly (neuroblastoma) | 1.40 | 0.13 | 2.00 |
Items per page:
1 – 4 of 4