rs299575 chr2:123051385 A>G
- Sequence
gaacagtttatactaaggtagaca[A/G]agtctgccaaaatcagcacatcta
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.98 | 0.29 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP childhood obesity (body mass index (bmi)), obesity in children and adolescents with early age of onset , premature ovarian failure, rheumatoid arthritis