rs2997094 chr6:160862103 T>G
- Sequence
ttgggccctttgaactgcagactc[T/G]gaaagtgctcttttgtcaatgaga
- ASB in cell types
- HUES64 (embryonic stem cells)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 2.23 | -0.90 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1