rs3001340 chr1:2535014 G>A
- Sequence
agatctctccttggggctccaggc[G/A]ggagctgcagtgggggagggagga
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma)
- ASB for transcription factors
- AP2C_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2C_HUMAN | 2.45 | n/a | 2.00 | 0.62 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
