rs3008859 chr1:66925316 G>C
- Sequence
cgcagcttcctccctctggccatc[G/C]actgcctcccagcgccgccttttt
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma) upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.70 | 0.80 | 1.23 | 0.13 | Weak Discordant | |||
| STAG1_HUMAN | 1.88 | 0.78 | 1.55 | n/a | n/a | |||
| TCF21_HUMAN | -1.94 | 2.89 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood