rs3008860 chr1:66925320 G>C
- Sequence
gcttcctccctctggccatcgact[G/C]cctcccagcgccgcctttttgcct
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma) EOL-1 (Acute myeloid leukemia)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN TCF21_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.65 | 0.82 | 1.24 | -3.06 | Concordant | |||
| STAG1_HUMAN | 1.94 | 0.84 | 1.55 | n/a | n/a | |||
| TCF21_HUMAN | -4.94 | 2.87 | 2.00 | n/a | n/a | |||
| RAD21_HUMAN | 1.18 | -0.01 | 1.42 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood