rs301487 chr9:4662369 A>C
- Sequence
ccaggtcccgggatccgggccgcc[A/C]gctgcgatgccaagtccccggagg
- ASB in cell types
- HCT-116 (colon carcinoma) tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 1.12 | 0.11 | 1.18 | |||
| tibial nerve | 1.74 | -0.41 | 1.08 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood